Sequence ID | >PHG181005115 |
Genome ID | MF185726 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Mycobacterium phage Appletree2 (MF185726) |
Start position on genome | 62011 |
End posion on genome | 62085 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atgatttacc |
tRNA gene sequence |
GGCCCGCTAGGCGAATTGGCATAGCCGCCAGATTTAGGTTCTGGTGTTTCCGAGTTCGAT |
Downstream region at tRNA end position |
gaggtagctt |
Secondary structure (Cloverleaf model) | >PHG181005115 Leu TAG c ACgc gaggtagctt G - C G - C C - G C - G C - G G - C C - G T T T G G C T C A T A A A | | | | | G T G C G G C C G A G C G | | | T T G A G C C C A T G TGTTT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |