Sequence ID | >PHG181005431 |
Genome ID | MF347639 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage Samisti12 (MF347639) |
Start position on genome | 94000 |
End posion on genome | 94075 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tctcccttat |
tRNA gene sequence |
GGTCCAGTCGCACAGTCTGGTAGTGCAATTGACTTTTAATCTTTGTGGACGTGGGTTCGA |
Downstream region at tRNA end position |
tgccctttta |
Secondary structure (Cloverleaf model) | >PHG181005431 Lys TTT t ACtt tgccctttta G - C G - C T - A C - G C - G A - T G - C T A T C A C C C A T G A C | | | | | G C C A C G G T G G G C T | | | | T T G G T G C G T A A GTGGAC A - T T T T T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |