Sequence ID | >PHG181006072 |
Genome ID | MF775674 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Lactococcus phage LP9206b (MF775674) |
Start position on genome | 29860 |
End posion on genome | 29932 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttgcatatT |
tRNA gene sequence |
GCGAGCATAGTATAGTGGTAATGCTACAGATTCCAAACCTGTAAACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tcctttattt |
Secondary structure (Cloverleaf model) | >PHG181006072 Trp CCA T GTtc tcctttattt G + T C - G G - C A - T G + T C - G A - T T T T C A T C C A G A A | | + | | G T T A T G G T G G G C G | | + | T T G A T G C T A T AAAC A - T C - G A - T G - C A C T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |