Sequence ID | >PHG181006092 |
Genome ID | MF775684 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Lactococcus phage LP9801 (MF775684) |
Start position on genome | 29896 |
End posion on genome | 29967 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
catataataa |
tRNA gene sequence |
CAGGATATGGTGTCAATGGTAGCATACGTGTTTTGGGAACATGTGGTGTTGGTTCGAGTC |
Downstream region at tRNA end position |
gtggtgtata |
Secondary structure (Cloverleaf model) | >PHG181006092 Pro TGG a Atga gtggtgtata C - G A - T G - C G - C A - T T - A A - T T G T C G A C C A A A C G | + | | | G T T G T G G T T G G C G + | | + T T G G C A T T A A TGGT C - G G + T T - A G - C T - A T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |