Sequence ID | >PHG181006948 |
Genome ID | MG646669 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Salmonella phage BPS17W1 (MG646669) |
Start position on genome | 77108 |
End posion on genome | 77031 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaaattaat |
tRNA gene sequence |
GTTCCAGTAGACAAAATGGTATAGTCACCACTCTTTCAAAGTGGATATTTGAGGGTTCAA |
Downstream region at tRNA end position |
gttttgacag |
Secondary structure (Cloverleaf model) | >PHG181006948 Glu TTC t GCCA gttttgacag G - C T - A T - A C - G C - G A - T G - C T A T T T C C C A A A A A + | | | | A T A C A G G A G G G C G | | | T T G A G T C T A T A ATATTT C - G C - G A - T C - G T - A C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |