Sequence ID | >PHG181007040 |
Genome ID | MG649967 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Vibrio phage Thalassa (MG649967) |
Start position on genome | 74364 |
End posion on genome | 74440 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tccaaattat |
tRNA gene sequence |
GCGCGTGTAGCTCAGTTGGTTAGAGCATCTGACTTTTAATCAGGTGGTCGAAGGTTCGAG |
Downstream region at tRNA end position |
tacaccggaa |
Secondary structure (Cloverleaf model) | >PHG181007040 Lys TTT t ACCA tacaccggaa G - C C - G G - C C - G G - C T - A G + T T G T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T T A A TGGTC T + G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |