Sequence ID | >PHG181007143 |
Genome ID | MG676224 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Aeromonas phage AhSzq-1 (MG676224) |
Start position on genome | 62795 |
End posion on genome | 62869 |
Amino Acid | STOP |
Anticodon | CTA |
Upstream region at tRNA start position |
acataaattc |
tRNA gene sequence |
GGGGATGTAGCTCAATGGGAGAGCAGCGGACTCTAAATTCGCCGGTTGTGGGTTCGAGTC |
Downstream region at tRNA end position |
aatttagggg |
Secondary structure (Cloverleaf model) | >PHG181007143 STOP CTA c ACCA aatttagggg G - C G - C G + T G - C A - T T - A G - C T G T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C G A A CGGTT G - C C - G G - C G + T A - T C A T A C T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |