Sequence ID | >PHG181007572 |
Genome ID | MH015255 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Ruegeria phage vB_RpoS-V10 (MH015255) |
Start position on genome | 15350 |
End posion on genome | 15427 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caccaagttt |
tRNA gene sequence |
TGGCATGTAGTCTTCCGGGTGAAGGCGCTCGGCTGTTAACCGAGATTGAGGCTGGTTCGA |
Downstream region at tRNA end position |
attgacgata |
Secondary structure (Cloverleaf model) | >PHG181007572 Asn GTT t GCCA attgacgata T - A G - C G - C C - G A - T T + G G - C T G T C G A C C A C C T A | | | | | G G T C T G G C T G G C G | | + | T T G A G G C T G A G ATTGAG C - G T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |