Sequence ID | >PHG181008070 |
Genome ID | MH370367 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Salmonella phage S114 (MH370367) |
Start position on genome | 75695 |
End posion on genome | 75775 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccaaacaaat |
tRNA gene sequence |
GGGGATGTGGCGAAATTGGCAGACGCGCTAGATTTAGGTTCTAGTCTTCGGGTGTGGGTT |
Downstream region at tRNA end position |
aacattggat |
Secondary structure (Cloverleaf model) | >PHG181008070 Leu TAG t ACCA aacattggat G + T G - C G - C G - C A - T T - A G - C T G T C T C C C A T A A G | | | | G T A G C G G T G G G C G | | | T T G A C G C C A G G TCTTCGGGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |