Sequence ID | >PHG181008497 |
Genome ID | MH576964 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage Starbow (MH576964) |
Start position on genome | 92080 |
End posion on genome | 92155 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaggccccat |
tRNA gene sequence |
GATTCCTTAGCTCAGTTGGTAGAGCACCAGACTTTTAATCTGTTGTGGTCCTCGGTTCGA |
Downstream region at tRNA end position |
gaaaaatggt |
Secondary structure (Cloverleaf model) | >PHG181008497 Lys TTT t ACgt gaaaaatggt G - C A - T T - A T - A C - G C - G T - A T G T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T A A TGTGGTC C T C - G A - T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |