Sequence ID | >PHG181008522 |
Genome ID | MH576965 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage StarPlatinum (MH576965) |
Start position on genome | 87955 |
End posion on genome | 88036 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aagaattgat |
tRNA gene sequence |
GGGCTCGTGGTGGAATGGTATACACGCTAGTCTTAGGAACTAGTGCCGAAAGGATTGTGA |
Downstream region at tRNA end position |
tgatatgtaa |
Secondary structure (Cloverleaf model) | >PHG181008522 Leu TAG t ACtt tgatatgtaa G + T G - C G - C C - G T + G C - G G - C T G T C A C T C A T A A G | | | | | G G G G T G G T G A G C G | | | T T T A C A C A T G TGCCGAAAGGATT C - G T - A A - T G - C T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |