Sequence ID | >PHG181008536 |
Genome ID | MH576965 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage StarPlatinum (MH576965) |
Start position on genome | 96568 |
End posion on genome | 96650 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcgggcctat |
tRNA gene sequence |
GCGTAAGCGACGAAGTTGGAGAGTCGTGGCGGTCTGTAAAACCGTTCCTTCGGGTGAGTC |
Downstream region at tRNA end position |
gaggtttgta |
Secondary structure (Cloverleaf model) | >PHG181008536 Tyr GTA t ACgc gaggtttgta G - C C - G G - C T - A A - T A - T G - C T A C C A G T C A T T G A G | | | | | G G A G C A G T C A G C G | | | | T T A T C G T G A G G TCCTTCGGGTGA G + T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |