Sequence ID | >PHG181008655 |
Genome ID | MH590597 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Streptomyces phage LukeCage (MH590597) |
Start position on genome | 108718 |
End posion on genome | 108792 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaaggccgat |
tRNA gene sequence |
GGCCCTGTAGCAGAATGGTATATGCGGCGGTCTCAAAAACCGCGTCAATGTGGGTTCGAG |
Downstream region at tRNA end position |
ggcatataca |
Secondary structure (Cloverleaf model) | >PHG181008655 Leu CAA t ACat ggcatataca G + T G - C C - G C - G C - G T - A G - C T G T T A C C C A T A A A + | | | | G G G A C G G T G G G C G | | | T T T A T G C A T G GTCAAT G - C C - G G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |