| Sequence ID | >CHL1810000225 |
| Genome ID | AB893950 |
| Phylum/Class | Viridiplantae |
| Species | Dendrobium moniliforme (AB893950) |
| Start position on genome | 112710 |
| End posion on genome | 112789 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
tttaaggtaa |
| tRNA gene sequence |
GCCGCCATGGTGAAATTGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGG |
| Downstream region at tRNA end position |
agaattattc |
| Secondary structure (Cloverleaf model) | >CHL1810000225 Leu TAG
a Ataa agaattattc
G - C
C - G
C - G
G - C
C - G
C - G
A - T T G
T G A G C C A
T A A G | | | | | G
T A G T G C T C G G C
G | | | T T
G A C A C
T A G G TGCTAGAGCAT
C - G
T - A
G - C
C - G
T - A
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |