Sequence ID | >CHL1810000505 |
Genome ID | AP012494 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Gonium pectorale (AP012494) |
Start position on genome | 134894 |
End posion on genome | 134813 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agaaaaaata |
tRNA gene sequence |
GCCTTCGTGATGGAATTGGCAGACATCCTGGTTTTAGGCACCAGTGCTGAAAGGCGTGCC |
Downstream region at tRNA end position |
aattaacttt |
Secondary structure (Cloverleaf model) | >CHL1810000505 Leu TAG a Aata aattaacttt G - C C - G C - G T - A T - A C - G G - C T G T C G G C C A T A A G | | | | | A T G G T A G C C G G C G | | | T T G A C A T C A G C TGCTGAAAGGCGT C - G T - A G - C G - C T - A T C T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |