Sequence ID | >CHL1810000509 |
Genome ID | AP012494 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Gonium pectorale (AP012494) |
Start position on genome | 53964 |
End posion on genome | 53891 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acaaggtaac |
tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTTAGAGCGCCGCTTTGATAAGGCGGAAGTCAAAAGTTCAAA |
Downstream region at tRNA end position |
tagcaagtaa |
Secondary structure (Cloverleaf model) | >CHL1810000509 Ile GAT c Aact tagcaagtaa G - C G - C G - C C - G T - A A - T T - A T A T T T T T C A T G A A | | | | | A T C T C G A A A A G C G | | | | T T G G A G C T T A G AAGTC C - G C - G G - C C - G T + G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |