Sequence ID | >CHL1810001923 |
Genome ID | FJ968740 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Pedinomonas minor (FJ968740) |
Start position on genome | 92268 |
End posion on genome | 92195 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ctaagagctg |
tRNA gene sequence |
GGGCTATTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
cttacaaaag |
Secondary structure (Cloverleaf model) | >CHL1810001923 Ile GAT g Atgg cttacaaaag G - C G - C G - C C - G T - A A - T T - A T G T C G A C C A G G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |