| Sequence ID | >CHL1810001954 |
| Genome ID | FJ968741 |
| Phylum/Class | Viridiplantae |
| Species | Parachlorella kessleri (FJ968741) |
| Start position on genome | 116933 |
| End posion on genome | 117018 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tataaatagT |
| tRNA gene sequence |
GCATCCGTGGCAGAGTGGTCGATTGCACCGCACTCATAATGCGGCTCCGAAAGGACATCG |
| Downstream region at tRNA end position |
tttttcctgt |
| Secondary structure (Cloverleaf model) | >CHL1810001954 Met CAT
T AAtt tttttcctgt
G - C
C - G
A - T
T - A
C - G
C - G
G - C T G
T C A A C C A
T G A G | | | | | A
G G A C G G T T G G C
G + | | | T T
T T T G C
C G A A CTCCGAAAGGACATC
C - G
C - G
G - C
C - G
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |