Sequence ID | >CHL1810002025 |
Genome ID | FM957154 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Fucus vesiculosus (FM957154) |
Start position on genome | 10026 |
End posion on genome | 10113 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ataattttaT |
tRNA gene sequence |
GCATTTGTGGCCGAGTGGTTGAAGGCAACGGACTCATAATCCGTCTTCTTATTAGAACAA |
Downstream region at tRNA end position |
ttatttacta |
Secondary structure (Cloverleaf model) | >CHL1810002025 Met CAT T AAta ttatttacta G - C C - G A - T T - A T + G T - A G - C C A T C G A C C A T G A G | | | | | G G G C C G G C T G G C G | | | T T T A G G C T G A A CTTCTTATTAGAACAAC A - T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |