Sequence ID | >CHL1810002640 |
Genome ID | GU591327 |
Search identical group | |
Phylum/Class | Alveolata |
Species | Durinskia baltica CS-38 (GU591327) |
Start position on genome | 106256 |
End posion on genome | 106326 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gattatagtt |
tRNA gene sequence |
GGCGGTATGGCCAAGTGGTAAGGCAGTGGATTGCAAATCCTCTACCCCCAGTTCGAATCT |
Downstream region at tRNA end position |
gtatttcaac |
Secondary structure (Cloverleaf model) | >CHL1810002640 Cys GCA t Ttcg gtatttcaac G - C G - C C - G G - C G - C T + G A - T T A T G G G T C A G A G | | | | | G T A C C G C C C A G C G | | | T T G A G G C T A A TACC G - C T T G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |