Sequence ID | >CHL1810002666 |
Genome ID | GU591328 |
Search identical group | |
Phylum/Class | Alveolata |
Species | Kryptoperidinium foliaceum CCMP1326 (GU591328) |
Start position on genome | 112435 |
End posion on genome | 112508 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aagcaatatg |
tRNA gene sequence |
GCGGGTGTAGCCAAGTGGTTAAGGCAGTGGGTTGTGGTTCCACCATTCGCCGGTTCAAGT |
Downstream region at tRNA end position |
attgatatat |
Secondary structure (Cloverleaf model) | >CHL1810002666 His GTG g CCtt attgatatat G - C C - G G - C G + T G - C T - A G - C T G T T G G C C A T G A A + | | | | A G A C C G G C C G G C G | | | T T T A G G C T A A CATTC G - C T - A G - C G - C G + T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |