Sequence ID | >CHL1810005339 |
Genome ID | JQ237893 |
Search identical group | |
Phylum/Class | Euglenozoa |
Species | Euglena viridis NJ001 (JQ237893) |
Start position on genome | 28786 |
End posion on genome | 28715 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aacagcatta |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAACGGGTTTTGGCCCTGTCATTCGGAAGTTCGAATC |
Downstream region at tRNA end position |
aacttacaaa |
Secondary structure (Cloverleaf model) | >CHL1810005339 Gln TTG a Gttt aacttacaaa T - A G - C G + T G - C G - C T - A G - C T A T C C T C C A G A A | | | | G T A C C G G G A A G C G | | | T T G A G G C T A A CATTC A - T C - G G + T G - C G - C T C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |