| Sequence ID | >CHL1810007563 |
| Genome ID | KC180797 |
| Phylum/Class | Viridiplantae |
| Species | Eucalyptus microcorys (KC180797) |
| Start position on genome | 34461 |
| End posion on genome | 34534 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
aatcaaatgG |
| tRNA gene sequence |
GCCCTTTTAACTCAGTGGTAGAGTAACGCCATGGTAAGGCGTAAGTCATCGGTTCAAATC |
| Downstream region at tRNA end position |
tttttcataa |
| Secondary structure (Cloverleaf model) | >CHL1810007563 Thr GGT
G TTtt tttttcataa
G - C
C - G
C - G
C - G
T + G
T - A
T - A T A
T T A G C C A
G A A | | | | | A
T C T C A A T C G G C
G | | | | T T
G G A G T
T A A AAGTC
A - T
C - G
G - C
C - G
C - G
A A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |