Sequence ID | >CHL1810008373 |
Genome ID | KC509523 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Didymosphenia geminata BCC011 (KC509523) |
Start position on genome | 16888 |
End posion on genome | 16816 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
catacaatta |
tRNA gene sequence |
GGGCCTATCGTCTAACGGATCAGGACAGAAACCTTCTAAGTTTCCAATGTAGGTTCGATT |
Downstream region at tRNA end position |
tataattaac |
Secondary structure (Cloverleaf model) | >CHL1810008373 Arg TCT a Aatc tataattaac G + T G - C G - C C - G C - G T + G A - T T T T C A T C C A C A A C | | | | | G G T C T G G T A G G C G + | | | T T A G G A C T C A A CAAT G - C A - T A - T A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |