Sequence ID | >CHL1810008582 |
Genome ID | KC573041 |
Search identical group | |
Phylum/Class | Haptophyceae |
Species | Pavlova lutheri ATCC 50092 (KC573041) |
Start position on genome | 38184 |
End posion on genome | 38111 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttgagtaag |
tRNA gene sequence |
GCGAGTGTGGCCAAGTGGTTACGGCACTGGATTGTGATTCCAGCATTCGCGGGTTCGATT |
Downstream region at tRNA end position |
tgtaatagat |
Secondary structure (Cloverleaf model) | >CHL1810008582 His GTG g CCtt tgtaatagat G - C C - G G - C A - T G + T T - A G - C T T T T G C C C A T G A G + | | | | G G A C C G G C G G G C G | | | T T T C G G C T A A CATTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |