| Sequence ID | >CHL1810010463 |
| Genome ID | KF539844 |
| Phylum/Class | Viridiplantae |
| Species | Asclepias nivea (KF539844) |
| Start position on genome | 115312 |
| End posion on genome | 115239 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
ctcccgttgT |
| tRNA gene sequence |
TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATC |
| Downstream region at tRNA end position |
tgattcattc |
| Secondary structure (Cloverleaf model) | >CHL1810010463 Asn GTT
T GAtt tgattcattc
T - A
C - G
C - G
T + G
C - G
A - T
G + T T A
T C A T C C A
G A A | | | | | G
T C T C G G T A G G C
G | | | | T T
G G A G C
T A G TGGTC
G + T
T - A
C - G
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |