Sequence ID | >CHL1810010640 |
Genome ID | KF733443 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Eunotia naegelii utex FD354 (KF733443) |
Start position on genome | 37321 |
End posion on genome | 37247 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
actatgttaT |
tRNA gene sequence |
GCGTCCTTAGTTCAGTTGGTAGAACGCTAGTCTCCAAAATTAGATGTCGAGGGTTCGAGT |
Downstream region at tRNA end position |
ctcttatttt |
Secondary structure (Cloverleaf model) | >CHL1810010640 Trp CCA T GAtt ctcttatttt G - C C - G G - C T - A C - G C - G T - A T G T C T T C C A T G A A | | + | | G T C T T G G A G G G C G | | | | T T G G A A C T A G ATGTC C - G T - A A - T G + T T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |