Sequence ID | >CHL1810012159 |
Genome ID | KJ614410 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Triticum timopheevii (KJ614410) |
Start position on genome | 51919 |
End posion on genome | 51993 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtgataaatT |
tRNA gene sequence |
GCCTACTTAACTCAGTGGTTAGAGTATTGCTTTCATACGGCGGGAGTCATTGGTTCAAAT |
Downstream region at tRNA end position |
aggtagaaaa |
Secondary structure (Cloverleaf model) | >CHL1810012159 Met CAT T AAgt aggtagaaaa G + T C - G C - G T - A A - T C - G T - A T A T T A A C C A T G A A | | | | | A G C T C A A T T G G C G | | | | T T T G A G T T A A GAGTC T + G T + G G - C C - G T + G T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |