Sequence ID | >CHL1810013181 |
Genome ID | KJ806277 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Camellia pubicosta (KJ806277) |
Start position on genome | 38283 |
End posion on genome | 38356 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aaaatcaaat |
tRNA gene sequence |
GCGGATATAGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gggtgaagtc |
Secondary structure (Cloverleaf model) | >CHL1810013181 Gly GCC t CCCA gggtgaagtc G - C C - G G - C G - C A - T T - A A - T T T T C G C C C A A A A | | | | | G T G C T G G C G G G C G | + T T G A A A T T A T AGAC T - A C - G T - A C - G T + G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |