Sequence ID | >CHL1810013645 |
Genome ID | KJ958482 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Rhizosolenia imbricata (KJ958482) |
Start position on genome | 62246 |
End posion on genome | 62321 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aataattagT |
tRNA gene sequence |
CGGGATATAGCTCAGTTTGGTAGAGTGCCTGCTTTGGGAGCAGGATGTCATAGGTTCAAA |
Downstream region at tRNA end position |
actttttctt |
Secondary structure (Cloverleaf model) | >CHL1810013645 Pro TGG T ATtg actttttctt C - G G - C G - C G - C A - T T - A A - T T A T T A T C C A T G A A | | | | | A T C T C G A T A G G C T | | | + T T G G A G T G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |