Sequence ID | >CHL1810013732 |
Genome ID | KJ958485 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Thalassiosira weissflogii (KJ958485) |
Start position on genome | 50023 |
End posion on genome | 50106 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tataatgttT |
tRNA gene sequence |
GGGTCGATGCCCGAGTGGTTAAAGGGGGCGGATTGTAAATCCGCTGTGTAATGCTACGTT |
Downstream region at tRNA end position |
aaaagaaaat |
Secondary structure (Cloverleaf model) | >CHL1810013732 Tyr GTA T AAta aaaagaaaat G - C G - C G - C T + G C - G G - C A - T T A T C A A C C A T G A G | | | | | A G G C C C G T T G G C G | | | T T T A G G G T A A G TGTGTAATGCTAC G - C C - G G - C G - C A - T T A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |