Sequence ID | >CHL1810014142 |
Genome ID | KM103376 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Wisteria floribunda (KM103376) |
Start position on genome | 31382 |
End posion on genome | 31307 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
atcaaacggG |
tRNA gene sequence |
GCCCTTTTAACTCAGTGTGGTAGAGTAACGCCATGGTAAGGCGTAAGTCATCGGTTCAAA |
Downstream region at tRNA end position |
tacttttttt |
Secondary structure (Cloverleaf model) | >CHL1810014142 Thr GGT G TTtt tacttttttt G - C C - G C - G C - G T + G T - A T - A T A T T A G C C A T G A A | | | | | A G C T C A A T C G G C T | | | | T T G G A G T G T A A AAGTC A - T C - G G - C C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |