Sequence ID | >CHL1810014833 |
Genome ID | KM462872 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Xylochloris irregularis (KM462872) |
Start position on genome | 78301 |
End posion on genome | 78377 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ggtcggtgct |
tRNA gene sequence |
GGGCTATTAGCTCAGTTGGTGAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
aggggatgta |
Secondary structure (Cloverleaf model) | >CHL1810014833 Ile GAT t ACCA aggggatgta G - C G - C G - C C - G T - A A - T T - A T A T T G A C C A T G A A + | | | | A T C T C G G C T G G C G | | | | T T G G A G C T G A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |