Sequence ID | >CHL1810015272 |
Genome ID | KM462887 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Elliptochloris bilobata (KM462887) |
Start position on genome | 129393 |
End posion on genome | 129473 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttgaaaaaa |
tRNA gene sequence |
GCCCCTGTGATGGAATTGGTAGACATGCGAGTTTTAGGAACTCGTGCCTTCGGCGTGTCG |
Downstream region at tRNA end position |
agatgagagt |
Secondary structure (Cloverleaf model) | >CHL1810015272 Leu TAG a Aatg agatgagagt G - C C - G C - G C - G C - G T + G G - C T G T C A G C C A T A A G | | | | | G T G G T A G T C G G C G | | | T T G A C A T T A G G TGCCTTCGGCGT C - G G - C A - T G - C T - A T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |