Sequence ID | >CHL1810016732 |
Genome ID | KP202881 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Cattleya liliputana (KP202881) |
Start position on genome | 37761 |
End posion on genome | 37832 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgaagaaaat |
tRNA gene sequence |
GCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ggtgaagtaa |
Secondary structure (Cloverleaf model) | >CHL1810016732 Gly GCC t CCat ggtgaagtaa G - C C - G G - C G - C A - T T - A A - T T T T C G C C C A A A G | | | | | G T G C T G G C G G G C G | + T T G A A A T T A T AGAT T - A C - G T - A C - G T + G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |