| Sequence ID | >CHL1810017223 |
| Genome ID | KP294386 |
| Phylum/Class | Viridiplantae |
| Species | Iochroma nitidum (KP294386) |
| Start position on genome | 96875 |
| End posion on genome | 96793 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ctttcaagaT |
| tRNA gene sequence |
GCCTTGGTGGTGAAATGGTAGACACGCGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAG |
| Downstream region at tRNA end position |
tattgagaat |
| Secondary structure (Cloverleaf model) | >CHL1810017223 Leu CAA
T ATaa tattgagaat
G - C
C - G
C - G
T - A
T - A
G - C
G + T T G
T T C T C C A
T A A G + | | | | G
G A G T G G G A G G C
G | | | T T
T A C A C
A G G TGCTAAAGAGCGT
C - G
G - C
A - T
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |