Sequence ID | >CHL1810017293 |
Genome ID | KP297244 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Actinidia deliciosa (KP297244) |
Start position on genome | 10043 |
End posion on genome | 10114 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tgaatgaaaa |
tRNA gene sequence |
GCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTGGTATAGGTTCAAATC |
Downstream region at tRNA end position |
tatttccata |
Secondary structure (Cloverleaf model) | >CHL1810017293 Arg TCT a Aaat tatttccata G - C C - G G - C T - A C - G C - G A - T T A T T A T C C A T A A T | | | | | A G T C T G A T A G G C G + | | | T T A G G A C T A A TGGT G + T A - T G - C G - C T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |