| Sequence ID | >CHL1810018606 |
| Genome ID | KR136270 |
| Phylum/Class | Viridiplantae |
| Species | Dendropanax morbifer (KR136270) |
| Start position on genome | 68990 |
| End posion on genome | 68915 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gaccgattga |
| tRNA gene sequence |
AGGGATGTAGCGCAGCTTGGTAGCGCGTTTGTTTTGGGTACAAAATGTCACGGGTTCAAA |
| Downstream region at tRNA end position |
attacttctc |
| Secondary structure (Cloverleaf model) | >CHL1810018606 Pro TGG
a ACCt attacttctc
A - T
G - C
G - C
G - C
A - T
T - A
G - C T A
T T G T C C A
C G A A | | + | | A
T C G C G A C G G G C
T | | | | T T
G G C G C
G T A G ATGTC
T - A
T - A
T - A
G - C
T - A
T T
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |