Sequence ID | >CHL1810019277 |
Genome ID | KR709240 |
Search identical group | |
Phylum/Class | Stramenopiles |
Species | Pseudo-nitzschia multiseries (KR709240) |
Start position on genome | 51817 |
End posion on genome | 51904 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
taatcttttt |
tRNA gene sequence |
GGCGAGATGGCAGAGTTGGTCGATTGCGTCTGATTTGAAATCAGATGAATCTTTACAGGT |
Downstream region at tRNA end position |
ttaaaaggtt |
Secondary structure (Cloverleaf model) | >CHL1810019277 Ser TGA t Ttta ttaaaaggtt G - C G - C C - G G - C A - T G - C A - T T A T C A C C C A T T G A G | | | | | G G G A C G G T G G G C G + | | | T T T T T G C C G A G TGAATCTTTACAGGTTCC T - A C - G T - A G - C A - T T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |