Sequence ID | >CHL1810019951 |
Genome ID | KT199251 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Chromochloris zofingiensis UTEX 56 (KT199251) |
Start position on genome | 133138 |
End posion on genome | 133219 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atttgctaaa |
tRNA gene sequence |
GCCTTCGTGATGGAACTGGTAGACATCCTGGTTTTAGGAACCAGTGCACTTGTGCGTGTC |
Downstream region at tRNA end position |
tgctgataat |
Secondary structure (Cloverleaf model) | >CHL1810019951 Leu TAG a Agtt tgctgataat G - C C - G C - G T - A T - A C - G G - C T A T C A G C C A C A A G | | | | | G T G G T A G T C G G C G | | | T T G A C A T T A G C TGCACTTGTGCGT C - G T - A G - C G - C T - A T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |