| Sequence ID | >CHL1810019978 |
| Genome ID | KT199252 |
| Phylum/Class | Viridiplantae |
| Species | Chlorotetraedron incus SAG 43.81 (KT199252) |
| Start position on genome | 115542 |
| End posion on genome | 115623 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
aattttttta |
| tRNA gene sequence |
GCCTTCGTGATGAAATTGGTAGACATCCTGGTTTTAGGAACCAGTGCATTTATGCGTGTC |
| Downstream region at tRNA end position |
ttatgataaa |
| Secondary structure (Cloverleaf model) | >CHL1810019978 Leu TAG
a Attt ttatgataaa
G - C
C - G
C - G
T - A
T - A
C - G
G - C T G
T C A G C C A
T A A G | | | | | G
T A G T A G T C G G C
G | | | T T
G A C A T
T A G C TGCATTTATGCGT
C - G
T - A
G - C
G - C
T - A
T A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |