Sequence ID | >CHL1810021710 |
Genome ID | KT625415 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Hafniomonas laevis (KT625415) |
Start position on genome | 114398 |
End posion on genome | 114326 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
catataagaa |
tRNA gene sequence |
AGGCCCATAACTCAGTCGGTAGAGTGATTGCCTTACAAGCAATAGGTCATCGGTTCGAGT |
Downstream region at tRNA end position |
tttcataaaa |
Secondary structure (Cloverleaf model) | >CHL1810021710 Val TAC a Aaac tttcataaaa A - T G - C G - C C - G C - G C - G A - T T G T T G G C C A T G A A | + | | | G C C T C A A T C G G C G | | | | T T G G A G T T A G AGGTC A - T T - A T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |