Sequence ID | >CHL1810022351 |
Genome ID | KT722983 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Cymbidium ensifolium (KT722983) |
Start position on genome | 7110 |
End posion on genome | 7039 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caactaaaaa |
tRNA gene sequence |
TGGGGCGTGGCCAAGCGGTAAGGCAACGGGTTTTGGTCCCGTTATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
gtttgcatcc |
Secondary structure (Cloverleaf model) | >CHL1810022351 Gln TTG a Gatc gtttgcatcc T - A G - C G - C G - C G + T C - G G - C T A T C T T C C A G A G | + | | | G C A C C G G G A G G C G | | | T T G A G G C T A A TATTC A - T C - G G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |