Sequence ID | >CHL1810022883 |
Genome ID | KT820667 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Aconitum coreanum (KT820667) |
Start position on genome | 55101 |
End posion on genome | 55173 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgataaatg |
tRNA gene sequence |
ACCTACTTAACCCAGTGGTTAGAGTATTGCTTTCATACGGCAGGAGTCATTGGTTCAAAT |
Downstream region at tRNA end position |
cttattagat |
Secondary structure (Cloverleaf model) | >CHL1810022883 Met CAT g Agag cttattagat A - T C - G C - G T - A A - T C - G T - A T A T T A A C C A T G A A | | | | | A G C C C A A T T G G C G | | | T T T G A G T T A A GAGTC T + G T - A G - C C - G T + G T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |