| Sequence ID | >CHL1810024446 |
| Genome ID | KU179435 |
| Phylum/Class | Viridiplantae |
| Species | Cymbidium kanran (KU179435) |
| Start position on genome | 85639 |
| End posion on genome | 85713 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
aagggaaggg |
| tRNA gene sequence |
GCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGGGTTCAAT |
| Downstream region at tRNA end position |
catattattt |
| Secondary structure (Cloverleaf model) | >CHL1810024446 His GTG
g CCat catattattt
G - C
C - G
G - C
G + T
A - T
T + G
G - C T T
T T G C C C A
T G A A + | | | | A
G A C C G G C G G G C
G | | | T T
A A G G C
T C A A CATGC
G - C
T - A
G - C
G - C
A - T
T A
T A
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |