| Sequence ID | >CHL1810025374 |
| Genome ID | KU291479 |
| Phylum/Class | Viridiplantae |
| Species | Paspalum glaziovii (KU291479) |
| Start position on genome | 47734 |
| End posion on genome | 47660 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tgttatgtaA |
| tRNA gene sequence |
GCCCACTTAGCTCAGAGGTTAGAGCATCGCATTTGTAATGCGAGGGTCATCGGTTCAAAT |
| Downstream region at tRNA end position |
ttctctatcg |
| Secondary structure (Cloverleaf model) | >CHL1810025374 Thr TGT
A TTtt ttctctatcg
G - C
C - G
C - G
C C
A - T
C - G
T - A T A
T T A G C C A
A G A A | | | | | A
G C T C G A T C G G C
G | | | | T T
T G A G C
T A A GGGTC
T - A
C - G
G - C
C - G
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |