Sequence ID | >CHL1810027272 |
Genome ID | KU724130 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Stenogyne haliakalae GEO5 (KU724130) |
Start position on genome | 110350 |
End posion on genome | 110429 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtcaagacag |
tRNA gene sequence |
GCCGCTATGGTGAAATCGGTAGACACGCTGCTCTTAGGAAGCAGTGCTAGAGCATCTCGG |
Downstream region at tRNA end position |
catttcttaa |
Secondary structure (Cloverleaf model) | >CHL1810027272 Leu TAG g Atat catttcttaa G - C C - G C - G G - C C - G T + G A - T T G T G A G C C A T A A G | | | | | G C A G T G C T C G G C G | | | T T G A C A C T A G G TGCTAGAGCAT C - G T - A G - C C - G T - A C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |