Sequence ID | >CHL1810030911 |
Genome ID | KX109945 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Arundo donax (KX109945) |
Start position on genome | 136660 |
End posion on genome | 136586 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tggataaggg |
tRNA gene sequence |
GCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGGGTTCAAT |
Downstream region at tRNA end position |
cgcattattg |
Secondary structure (Cloverleaf model) | >CHL1810030911 His GTG g CCat cgcattattg G - C C - G G - C G + T A - T T + G G - C T T T T G C C C A T G A A + | | | | A G A C C G G C G G G C G | | | T T A A G G C T C A A CATGC G - C T - A G - C G - C A - T T A T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |