Sequence ID | >CHL1810031158 |
Genome ID | KX180050 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Afrolicania elaeosperma (KX180050) |
Start position on genome | 47375 |
End posion on genome | 47464 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcgttatgta |
tRNA gene sequence |
GGAAAGATGGCCGAGTGGTTCAAGGCGTAGCATTGGAACTGCTATGTAGGCTTTTTTTGT |
Downstream region at tRNA end position |
cttcatctaa |
Secondary structure (Cloverleaf model) | >CHL1810031158 Ser GGA a Gtac cttcatctaa G - C G - C A - T A - T A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T C A G TGTAGGCTTTTTTTGTTTACC T - A A - T G - C C - G A - T T C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |