Sequence ID | >CHL1810031913 |
Genome ID | KX180079 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Licania michauxii (KX180079) |
Start position on genome | 50565 |
End posion on genome | 50638 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atcagaaatg |
tRNA gene sequence |
GTCGGGATAGCTCAGCTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAGTTCAAAT |
Downstream region at tRNA end position |
gattaatttg |
Secondary structure (Cloverleaf model) | >CHL1810031913 Phe GAA g ACat gattaatttg G - C T + G C - G G + T G - C G - C A - T T A T T G G T C A C G A A | | | | | A T C T C G A C C A G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |